View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17915_low_22 (Length: 242)
Name: NF17915_low_22
Description: NF17915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17915_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 19 - 222
Target Start/End: Original strand, 44530992 - 44531195
Alignment:
| Q |
19 |
aagatagacattccattagaagctcccatagctaaacaagcaacacctaaacttgaatcagcaatcatataattttcaccaggcaattccaaatcaccac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44530992 |
aagatagacattccattagaagctcccatagctaaacaagcaacacctaaacttgaatcagcaatcatataattttcaccaggcaattccaaatcaccac |
44531091 |
T |
 |
| Q |
119 |
ctttgaaatgaaaaactaattttggaatttcaacttctgttttccctgatggcaaactaaaacaaacatctaatccagttgaacccgatttatcgaccgg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44531092 |
ctttgaaatgaaaaactaattttggaatttcaacttctgttttccctgatggcaaactaaaacaaacatctaatccagttgaacccgatttatcgaccgg |
44531191 |
T |
 |
| Q |
219 |
taat |
222 |
Q |
| |
|
|||| |
|
|
| T |
44531192 |
taat |
44531195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University