View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17915_low_30 (Length: 224)
Name: NF17915_low_30
Description: NF17915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17915_low_30 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 28 - 224
Target Start/End: Original strand, 4354327 - 4354523
Alignment:
| Q |
28 |
taacacactatggatcctaaccctgctctcaaagccttgagtgaaagttttcagtgacagtaatcatatgcttcatgccttcactgcacaaagcgcatgg |
127 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4354327 |
taacacactatggatcctaaacctgctctcaaagccttgagtgaaagttttcagtgacagtaatcatatgcttcatgccttcacttcacaaagcgcatgg |
4354426 |
T |
|
| Q |
128 |
agttggatcacttcttcatgtgtgaatttgtccatgttcccctcttagttaaccatgcctctatcaccaatcaaatatattcatctcaaaaacaagc |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4354427 |
agttggatcacttcttcatgtgtgaatttgtccatgttcccctcttagttaaccatgcctctatcaccaatcaaatatattcatctcaaaaacaagc |
4354523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University