View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17916_high_10 (Length: 269)
Name: NF17916_high_10
Description: NF17916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17916_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 13 - 90
Target Start/End: Complemental strand, 8804249 - 8804172
Alignment:
| Q |
13 |
tcagatgacaaccaagacatctcgtggaggttttggaagatatggaatgaaggttatcaaggttcaataaagctatga |
90 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8804249 |
tcagatgacaaccaagacacctcatggaggttttggaagatatggaatgaaggttatcaaggttcaataaggctatga |
8804172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 87 - 229
Target Start/End: Complemental strand, 8804134 - 8803998
Alignment:
| Q |
87 |
atgagtaagtcggatacgaaagctattcaaagaacatnnnnnnnggaagtttccgcacctaaaactcaagcctcgtgcatgggcagagagcaaagctttt |
186 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||| |||||||||||||||||||||||| ||||||| |||||||||| |||||||| |
|
|
| T |
8804134 |
atgagtaagtcggatacagaagttattcaaagaacataaaaaa-ggaagtttccgcacctaaaactcaggcctcgttcatgggcaga-----aagctttt |
8804041 |
T |
 |
| Q |
187 |
gctctctgttagctgtcatgcgccctacaggtgttgttttgaa |
229 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
8804040 |
gctctctgttagctgtcatgcgcccagcgggtgttgttttgaa |
8803998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 82
Target Start/End: Complemental strand, 29529435 - 29529395
Alignment:
| Q |
42 |
gttttggaagatatggaatgaaggttatcaaggttcaataa |
82 |
Q |
| |
|
||||||||||| ||| ||||||| ||||||||||||||||| |
|
|
| T |
29529435 |
gttttggaagacatgaaatgaagattatcaaggttcaataa |
29529395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University