View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17917_high_18 (Length: 240)
Name: NF17917_high_18
Description: NF17917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17917_high_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 2 - 226
Target Start/End: Original strand, 291429 - 291659
Alignment:
| Q |
2 |
tatatcagtgttaaaggggatatataggaaagttggaaagaaccttcaaatcattggtgaacaaaggtttt------taagaggctgagataaagaattg |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
291429 |
tatatcagtgttaaaggggatatataggaaagttggacagaaccttcaaatcattggtgaacaaaggtttttttttttaagaggctgagataaagaattg |
291528 |
T |
|
| Q |
96 |
gtttgattgtgatttctagcaatttgagtggtagttttaggattgaaccggttagtttattgaaacccatcaactctgcaatgtttatgagataattcat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
291529 |
gtttgattgtgatttctagcaatttgagtggtagttttaggattgaaccggttagtttattgaaacccatcaactctgcaatgtttatgagataattcat |
291628 |
T |
|
| Q |
196 |
ggtgtttgggagagacagagatagggaattg |
226 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |
|
|
| T |
291629 |
ggtgtttgggagagacagagatggggaattg |
291659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 81 - 210
Target Start/End: Complemental strand, 40261031 - 40260901
Alignment:
| Q |
81 |
tgagataaagaattgg-tttgattgtgatttctagcaatttgagtggtagttttaggattgaaccggttagtttattgaaacccatcaactctgcaatgt |
179 |
Q |
| |
|
||||||| | |||||| ||||||||||| ||||||||| || | |||||||||| |||||||| |||||||||||||||||| | | |||| || ||||| |
|
|
| T |
40261031 |
tgagatatataattggctttgattgtgaattctagcaaattcaatggtagttttgggattgaagcggttagtttattgaaactcgttaactatggaatgt |
40260932 |
T |
|
| Q |
180 |
ttatgagataattcatggtgtttgggagaga |
210 |
Q |
| |
|
|| ||||| ||||||||||||||||| |||| |
|
|
| T |
40260931 |
ttgtgagagaattcatggtgtttgggggaga |
40260901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University