View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17917_low_12 (Length: 325)
Name: NF17917_low_12
Description: NF17917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17917_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 152 - 306
Target Start/End: Complemental strand, 53772864 - 53772712
Alignment:
| Q |
152 |
acatggcggtttgattttgatttggcataataaacaagagaaatattcataattgggtgattaaaattaaaatgaatagagtttgaattggcatacttgg |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
53772864 |
acatggcggtttgattttgatttggcataataaacaagagaaatattcataattgggtgattaaaattaaaatgaat--agtttgaattggcatacttgg |
53772767 |
T |
 |
| Q |
252 |
aagtgttggtgatattggaagaagtggaagagaagaaggagacagaggcccagtc |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53772766 |
aagtgttggtgatattggaagaagtggaagagaagaaggagacagaggcccagtc |
53772712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 27 - 125
Target Start/End: Complemental strand, 53772989 - 53772891
Alignment:
| Q |
27 |
cgacaatttccatcataaaattattcagaggaagaataaaactttgcaatcaaaatcaaattcggtccatgtcaaatttgtgattcagataggttaatg |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53772989 |
cgacaatttccatcataaaattattcagaggaagaataaaactttgcaatcaaaatcaaattcggtccatgtcaaatttgtgattcagataggttaatg |
53772891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University