View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17917_low_13 (Length: 321)
Name: NF17917_low_13
Description: NF17917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17917_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 10 - 306
Target Start/End: Original strand, 27785634 - 27785931
Alignment:
| Q |
10 |
aatatgggatattttgtctttgcaattggcactatgtatggacggtaacttcttggcattatgtttgcgtcgatctttttgatcaaagataatttctttt |
109 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |||||| | |||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27785634 |
aatatgtgatattttgtctttgcaattggcactatgtatgaacggtaccatcttggcattatgtttgcgttgatctttttgatcaaagataatttctttt |
27785733 |
T |
|
| Q |
110 |
tactttcttgatttgtattcaggctaccaagtggaccacgtacatgatgcaacaaattttgattcaagtttaattcatttactatatgtttgctttcgtt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27785734 |
tactttcttgatttgtattcaggctaccaagtggaccacgtacatgatgaaacgaattttgattcaagtttaattcatttactatatgtttggtttcgtt |
27785833 |
T |
|
| Q |
210 |
acttttgaatgatacaaaattgacttgcatgagaaattagtc-agggtaaacgaggattgcacggtaactctcagcattacgaatttccctccaaggt |
306 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27785834 |
acttttgaatgatacaaaatttacttgcatgagaaattagtcaagggtaaacgaggattgcacggtaactctcagcattacgaatttccccccaaggt |
27785931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University