View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17917_low_3 (Length: 433)
Name: NF17917_low_3
Description: NF17917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17917_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 407; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 407; E-Value: 0
Query Start/End: Original strand, 1 - 423
Target Start/End: Original strand, 43672313 - 43672735
Alignment:
| Q |
1 |
ccaaccttggattaaccgaaccgggttcatccggttcagacatggttcatgcctaccatgcttactcaccatccggttcagtttatgctaaggcggtgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43672313 |
ccaaccttggattaaccgaaccgggttcatctggttcagacatggttcatgcctaccatgcttattcaccatccggttcagtttatgctaaggcggtgtt |
43672412 |
T |
|
| Q |
101 |
tgtgaactacggaagagatagagactaccgtgcagttggcgtaagcattaagggatgtatagtgatagtaagaaaaggtggtggtttagggaggaacacg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43672413 |
tgtgaactacggaagagatagagactaccgtgcagttggcgtaagcattaagggatgtatagtgatagtaagaaaaggtggtggtttagggaggaacacg |
43672512 |
T |
|
| Q |
201 |
gtggttgaaaaggctgaggaaaacggtgctgtagcggttctggtttataatgatgagaatgacacgtggcgtgatgggtttgagagaggtcacgtgatga |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43672513 |
gtggttgaaaaggctgaggaaaacggtgctgtagcggttctagtttataatgatgagaatgacacgtggcgtaatgggtttgagagaggtcacgtgatga |
43672612 |
T |
|
| Q |
301 |
aaggtgtaggggacccacttagtcctggttggggtagtgttgaaggtagtgagaagttgagtttggatgataatgaagttttgaaaaggttccctaaaat |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43672613 |
aaggtgtaggggacccacttagtcctggttggggtagtgttgaaggtagtgagaagttgagtttggatgataatgaagttttgaaaaggttccctaaaat |
43672712 |
T |
|
| Q |
401 |
tccatctatgccactctctgctc |
423 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
43672713 |
tccatctatgccactctctgctc |
43672735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University