View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17917_low_7 (Length: 390)
Name: NF17917_low_7
Description: NF17917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17917_low_7 |
 | |
|
| [»] scaffold0002 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0002 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 21 - 380
Target Start/End: Original strand, 454454 - 454813
Alignment:
| Q |
21 |
cacaaaactttcatgtgttcacacaacttcatttcacagctttttctttgaatcgcacatttttctttgtcttcttcaatcaccctctttgtccttcgaa |
120 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
454454 |
cacacaactttcatgtgttcacacaacttcatttctcagctttttctttgaatcacacatttttctttgtcttcttcaatcaccctctttgtccttcgaa |
454553 |
T |
|
| Q |
121 |
atgccacaaacatcttcaatctcagtctcacgaagattttctgacaaggatcatagagtcaggagtacaagtgcagaacaagagcagcaaagcgcagtgc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
454554 |
atgccacaaacatcttcaatctcagtctcacgaagattttctaacaaggatcatagagtcaagagtacaagtgcagaacaagagcagcaaagcgcagtgc |
454653 |
T |
|
| Q |
221 |
agagaaggaaaggcgacgatgatttgctagatgaacttcaggataatcgcattcacaccgtcgccagaaggagagatgtttcccggtcacgatcaccggc |
320 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
454654 |
agagaaggaaaggtgatgatgatttgctagatgaacttcaggataatcgcattcacaccgtcgccagaaggagagatgtttcccggtcacgatcaccggc |
454753 |
T |
|
| Q |
321 |
ggtgaataagatgcattttgctattacattgcttgctgtgttatgtcccttcactctctg |
380 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
454754 |
agtgaataagatgcattttactattacattgcttgctgtgttatgtcccttcactctctg |
454813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 292 - 333
Target Start/End: Original strand, 22773700 - 22773741
Alignment:
| Q |
292 |
agagatgtttcccggtcacgatcaccggcggtgaataagatg |
333 |
Q |
| |
|
||||||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
22773700 |
agagatgtttctcggtcacgatctccgccggtgaataagatg |
22773741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University