View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17920_low_3 (Length: 306)
Name: NF17920_low_3
Description: NF17920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17920_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 13 - 297
Target Start/End: Original strand, 51957872 - 51958157
Alignment:
| Q |
13 |
aaaattcaacaaggtgtctagcgtatgttaaaagctctttcactccaagaggaagttcggaatcaaacgcgtgttgtaattcatttgtagacactccaag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51957872 |
aaaattcaacaaggtgtctagcgtatgttaaaagctctttcactccaagaggaagttcggaatcaaacgcgtgttgtaattcatttgtagacactccaag |
51957971 |
T |
 |
| Q |
113 |
aatcctacaaaacgcaaaatacgaagaa-tgaattataaataatcgattaaatgaaaaagttattgttgaaaggaatgaatgaaggaggatgagacttgg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
51957972 |
aatcctacaaaacgcaaaatacgaagaaatgaattataaataatcgattaaatgaaaaagttattgttgaaaggaatgaatgaaggagaatgagacttgg |
51958071 |
T |
 |
| Q |
212 |
aagaggtggagacgacttcgttggcgatgggagagagttgaggaataggtttgggggaattgacggaggagtgatcggtgatgatg |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51958072 |
aagaggtggagacgacttcgttggcgatgggagagagttgaggaataggtttgggggaattgacggaggagtgatcggtgatgatg |
51958157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University