View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17922_high_6 (Length: 425)
Name: NF17922_high_6
Description: NF17922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17922_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 52; Significance: 1e-20; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 15 - 101
Target Start/End: Complemental strand, 55080537 - 55080453
Alignment:
| Q |
15 |
atcaagtgacacatgttctatctctcttaattaattttagtgacctcactttgatgacatgactttccttccatttggaacataaca |
101 |
Q |
| |
|
|||||||||||||||| |||||||||| | ||||||||||||||||||||||||||||| ||||| ||||||||||| ||||||| |
|
|
| T |
55080537 |
atcaagtgacacatgtcctatctctctaac--aattttagtgacctcactttgatgacatggctttctttccatttggatcataaca |
55080453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 148 - 188
Target Start/End: Complemental strand, 5074830 - 5074790
Alignment:
| Q |
148 |
gacagggaatagtgaaggttttggttcgtcggagaacggtg |
188 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||| |||||| |
|
|
| T |
5074830 |
gacagggaagagtgaaggttttgcttcgtcggaggacggtg |
5074790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 248 - 338
Target Start/End: Original strand, 29265361 - 29265452
Alignment:
| Q |
248 |
cttcttccttctcttctccattccatctccatcagattccaaggaatctagaatcgtgtagga-ggaggtaaggacttctccggagatcgat |
338 |
Q |
| |
|
||||||||||||||| ||| ||| |||| |||||||||| | |||| ||||||| ||| || |||||||||||||||||||||| ||||| |
|
|
| T |
29265361 |
cttcttccttctcttttcctttcagtctcgatcagattccgaagaatatagaatcacgtatgaaggaggtaaggacttctccggaggtcgat |
29265452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University