View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17922_high_6 (Length: 425)

Name: NF17922_high_6
Description: NF17922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17922_high_6
NF17922_high_6
[»] chr4 (2 HSPs)
chr4 (15-101)||(55080453-55080537)
chr4 (148-188)||(5074790-5074830)
[»] chr8 (1 HSPs)
chr8 (248-338)||(29265361-29265452)


Alignment Details
Target: chr4 (Bit Score: 52; Significance: 1e-20; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 15 - 101
Target Start/End: Complemental strand, 55080537 - 55080453
Alignment:
15 atcaagtgacacatgttctatctctcttaattaattttagtgacctcactttgatgacatgactttccttccatttggaacataaca 101  Q
    |||||||||||||||| |||||||||| |   ||||||||||||||||||||||||||||| ||||| ||||||||||| |||||||    
55080537 atcaagtgacacatgtcctatctctctaac--aattttagtgacctcactttgatgacatggctttctttccatttggatcataaca 55080453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 148 - 188
Target Start/End: Complemental strand, 5074830 - 5074790
Alignment:
148 gacagggaatagtgaaggttttggttcgtcggagaacggtg 188  Q
    ||||||||| ||||||||||||| |||||||||| ||||||    
5074830 gacagggaagagtgaaggttttgcttcgtcggaggacggtg 5074790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 248 - 338
Target Start/End: Original strand, 29265361 - 29265452
Alignment:
248 cttcttccttctcttctccattccatctccatcagattccaaggaatctagaatcgtgtagga-ggaggtaaggacttctccggagatcgat 338  Q
    ||||||||||||||| ||| |||  |||| |||||||||| | |||| |||||||  ||| || |||||||||||||||||||||| |||||    
29265361 cttcttccttctcttttcctttcagtctcgatcagattccgaagaatatagaatcacgtatgaaggaggtaaggacttctccggaggtcgat 29265452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University