View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17922_high_9 (Length: 285)
Name: NF17922_high_9
Description: NF17922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17922_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 33435748 - 33435782
Alignment:
| Q |
1 |
tcatcaatcagtaatttcgtttccaactcttgggt |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
33435748 |
tcatcaatcagtaatttcgtttccaactcttgggt |
33435782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University