View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17922_low_10 (Length: 269)
Name: NF17922_low_10
Description: NF17922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17922_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 3 - 254
Target Start/End: Complemental strand, 52180015 - 52179764
Alignment:
| Q |
3 |
catgtcgaagaatattgttagggagatcaatgacatggagagattatgaattgctgggaatggacctaaaggtacagggcgcagtctccgacatagttta |
102 |
Q |
| |
|
|||| |||| ||||||||||||||||| ||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52180015 |
catgccgaaaaatattgttagggagattaatgacatggagagactatgaattgctggtaatggacctaaaggtacagggcgcagtctccgacatagttta |
52179916 |
T |
|
| Q |
103 |
aggatgacgtggatagttaccgtgatggagatgtaaaagaatatggcggagatgagaaaccaccatgtggctccccatgatagggcaggactccaccgga |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52179915 |
aggatgacgtggatagttaccgtgatggagatgtaaaagaatatggcggagatgagaaaccaccatgtggctccccatgatagggcaggactccaccgga |
52179816 |
T |
|
| Q |
203 |
atgaaacaattgatgggtgatctagtagccaatagttaagattctcctttgt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52179815 |
atgaaacaattgatgggtgatctagtagccaatagttaagattctcctttgt |
52179764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University