View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17923_high_10 (Length: 236)

Name: NF17923_high_10
Description: NF17923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17923_high_10
NF17923_high_10
[»] chr2 (1 HSPs)
chr2 (163-222)||(14395810-14395869)


Alignment Details
Target: chr2 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 163 - 222
Target Start/End: Complemental strand, 14395869 - 14395810
Alignment:
163 ttattgcaaaaactaagtagacttgcaaacggnnnnnnntaggaagtgaatgatccttct 222  Q
    ||||||||||||||||||||||||||||||||       |||||||||||||||||||||    
14395869 ttattgcaaaaactaagtagacttgcaaacggaaaaaaataggaagtgaatgatccttct 14395810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University