View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17923_high_12 (Length: 213)
Name: NF17923_high_12
Description: NF17923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17923_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 65; Significance: 9e-29; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 18 - 82
Target Start/End: Complemental strand, 3847153 - 3847089
Alignment:
| Q |
18 |
atcatgagaaaagaaactatccattctaacaaaataagttagttttacagattattagtaccatt |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3847153 |
atcatgagaaaagaaactatccattctaacaaaataagttagttttacagattattagtaccatt |
3847089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 144 - 181
Target Start/End: Complemental strand, 3847026 - 3846989
Alignment:
| Q |
144 |
agtaccattaacacacattttaaactcttttactatgt |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3847026 |
agtaccattaacacacattttaaactcttttactatgt |
3846989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University