View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17923_low_10 (Length: 250)
Name: NF17923_low_10
Description: NF17923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17923_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 32638601 - 32638383
Alignment:
| Q |
1 |
atgaataaatggaaagttccaaatttaaatatcaaccaatgtatattgcaatgtttaaaatttagtttcgagttttagtcaggtatttgatcaatgtaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
32638601 |
atgaataaatggaaagttccaaatttaaatatcaaccaatgtatattgcaatgtttaaaatttagtttcgagttctaatcaggtatttgatcaatgtaat |
32638502 |
T |
|
| Q |
101 |
aaagcttgaatccggctggagttagttttgagttcagatttactctatttatatatcctctattcacaacctcccaaccaaatgacaatttgtgataatt |
200 |
Q |
| |
|
||||||| ||||| ||| |||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32638501 |
aaagcttaaatccagctagagttaattttgagttcagatttgctctatttatatatcctctattcacaacctcccaaccaaatgacaatttgtgataatt |
32638402 |
T |
|
| Q |
201 |
ttattctgataacaatact |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
32638401 |
ttattctgataacaatact |
32638383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University