View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17924_high_26 (Length: 248)
Name: NF17924_high_26
Description: NF17924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17924_high_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 202
Target Start/End: Original strand, 44146758 - 44146945
Alignment:
| Q |
15 |
gagaagaacgtgctatctacacttgatttccagcttcaacaatgacatgagactccctgattccacatttgtttctcttccccaattacactaatttata |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44146758 |
gagaagaacgtgctatctacacttgatttccagcttcaacaatgacatgagactccctgattccacatttgtttctcttccccaattacactaatttata |
44146857 |
T |
|
| Q |
115 |
caccaaaaacgatccagtatcaacataactacaggctaatgccttcccagctgaggttggcagagaaaatgctagctgagtgcgttcg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44146858 |
caccaaaaacgatccagtatcaacataactacaggctaatgccttcccagctgaggttggcagagaaaatgctagctgagtgcgttcg |
44146945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University