View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17924_low_35 (Length: 215)
Name: NF17924_low_35
Description: NF17924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17924_low_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 11 - 202
Target Start/End: Complemental strand, 4040279 - 4040087
Alignment:
| Q |
11 |
gcataggatggtttgttatgatgaacttatttgtgttaagggtaatgtgataattagagatgatgatgtga-aataatcgaaaatcttgagaaggaagaa |
109 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4040279 |
gcataggatggtttgttatgatgaacttaattgtgttaagggtaatgtgataactagagatgatgatgtgataataatcgaaaatcttgagaaggaagaa |
4040180 |
T |
 |
| Q |
110 |
ggtttgaactaataagaaggtcgaagatgttgttaaagtattgaagtgtcaaaaatgatattcatagaccttgtcaaagattaattcaaatgt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4040179 |
ggtttgaactaataagaaggtcgaagatgttgttaaagtattgaagtgtcgaaaatgatattcatagaccttgtcaaagattaattcaaatgt |
4040087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University