View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17925_high_21 (Length: 317)
Name: NF17925_high_21
Description: NF17925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17925_high_21 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 6 - 317
Target Start/End: Original strand, 5957668 - 5957979
Alignment:
| Q |
6 |
agcaccacagagggagtttctacctacggtgcgtgtgcacgagtttccaatggacccagatatatacaccgaatggaagatgttacaatggaagccgccg |
105 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5957668 |
agcagcacagagggagtttctacctacggtgcgtgtgcaggagtttccaatggacccagatatatacacagaatggaagatgttacaatggaagccgccg |
5957767 |
T |
|
| Q |
106 |
gagtttgcgcgagcacctggtgggccaccgtcgaatgtggcggtggcccatgtcaggcttggcggacgggcggctttgttggggaaagttggggaggatg |
205 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5957768 |
gagtttgcgcgagcacctggtgggccgccgtcgaatgtggcggtggcccatgtcaggcttggcggacgggcggctttgttggggaaagttggggaggatg |
5957867 |
T |
|
| Q |
206 |
agtttggggaggagattgttttggggatgaataaggagaaggtgcagactagaggggtgaagtttgattcggggtttcggactgggtgtagttatatgaa |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5957868 |
agtttggggaggagattgttttggggatgaataaggagaaggtgcagactagaggggtgaagtttgattcggggtttcggactgggtgtagttatatgaa |
5957967 |
T |
|
| Q |
306 |
ggtgaagtttga |
317 |
Q |
| |
|
|||||||||||| |
|
|
| T |
5957968 |
ggtgaagtttga |
5957979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University