View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17925_low_2 (Length: 246)
Name: NF17925_low_2
Description: NF17925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17925_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 23 - 232
Target Start/End: Complemental strand, 5923621 - 5923412
Alignment:
| Q |
23 |
agcgcgatccctttgatgccggtaatgaccacggctgtacctgttccgatggcggttccgatgcaacaatcgggatcggtgatgccgtttagttttagtg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5923621 |
agcgcgatccctttgatgccggtaatgaccacggctgtacctgttccgatggcggttccgatgcaacaatcgggatcggtgatgccgtttagttttagtg |
5923522 |
T |
|
| Q |
123 |
cggagttgttgagtgtgatgcaggagatgattagaacagaggtgagaagttacatggcgggattggagcaacagaatgggatgtgttttcaaaaagctga |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5923521 |
cggagttgttgagtgtgatgcaggagatgattagaacagaggtgagaagttacatggcgggattggagcaacagaatgggatgtgttttcaaaaagctga |
5923422 |
T |
|
| Q |
223 |
ggatggaatt |
232 |
Q |
| |
|
|||||||||| |
|
|
| T |
5923421 |
ggatggaatt |
5923412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University