View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17926_high_6 (Length: 306)
Name: NF17926_high_6
Description: NF17926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17926_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 268; Significance: 1e-149; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 17 - 284
Target Start/End: Complemental strand, 37434531 - 37434264
Alignment:
| Q |
17 |
gaagatcgaaatttggtgcgtggagagtgtatggtttttctgattccggtcgtgggttaccgggtggatcggttgttcgtgaaatggaaacttcgtttga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37434531 |
gaagatcgaaatttggtgcgtggagagtgtatggtttttctgattccggtcgtgggttaccgggtggatcggttgttcgtgaaatggaaacttcgtttga |
37434432 |
T |
|
| Q |
117 |
gtttttatcagttaacggaaaagggggttttagggaggtgacggagttagggttcgaagaagggaatgtggtggttgttgaagaaaaagctgtgaaaatg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37434431 |
gtttttatcagttaacggaaaagggggttttagggaggtgacggagttagggttcgaagaagggaatgtggtggttgttgaagaaaaagctgtgaaaatg |
37434332 |
T |
|
| Q |
217 |
gaaggtgatgatgagaatgagattgttgtgagagcttatcctaggagtggaagaacacatcagattcg |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37434331 |
gaaggtgatgatgagaatgagattgttgtgagagcttatcctaggagtggaagaacacatcagattcg |
37434264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 62 - 283
Target Start/End: Complemental strand, 37427201 - 37426979
Alignment:
| Q |
62 |
ccggtcgtgggttaccgggtggatcggttgttcgtgaaatggaaacttcgtttgagtttttatcagttaacggaaaagggggttttagggaggtgacgga |
161 |
Q |
| |
|
|||||||||| |||| ||||||||| ||||| ||| |||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||| |||| |
|
|
| T |
37427201 |
ccggtcgtggattactgggtggatcagttgtccgtaaaatggaaacttcgtttgaggttttatctgttaacggaaaagggggtttcagggaggtggcgga |
37427102 |
T |
|
| Q |
162 |
gttagggttcgaagaagggaatgtggtggttgttgaagaaaaagctgtgaaaatggaaggtgatgatga---gaatgagattgttgtgagagcttatcct |
258 |
Q |
| |
|
||||||||| |||| | ||| ||||||||||||||||||||| ||||||||||| |||| |||||| ||||||||| || || || |||||||| |
|
|
| T |
37427101 |
gttagggtttgaagtgagtgatggggtggttgttgaagaaaaagcggtgaaaatggagggtgctgatgaagggaatgagatagtcgt--gaacttatcct |
37427004 |
T |
|
| Q |
259 |
aggagtggaagaacacatcagattc |
283 |
Q |
| |
|
|||| |||||||||||||||||||| |
|
|
| T |
37427003 |
aggattggaagaacacatcagattc |
37426979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University