View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17926_low_5 (Length: 335)
Name: NF17926_low_5
Description: NF17926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17926_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 13 - 320
Target Start/End: Complemental strand, 43098994 - 43098687
Alignment:
| Q |
13 |
atactaatgtaagtgtcatcaaatggtgagctagacctgacatacaagttttagacagtagtactatatgattttgcattttgcaagctgctgttagtct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43098994 |
atactaatgtaagtgtcatcaaatggtgagctagacctgacatacaagttttagacggtagtactatatgattttgcattttgcaagcagctgttagtct |
43098895 |
T |
|
| Q |
113 |
gttacatgttctagttttcgaactttattaaatgctgaccaaacttgtctcttttgcctgacattgttacagctagtttaacatgcatgggttaatttat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43098894 |
gttacatgttctagttttcgaactttattaaatgctgaccaaacttgtctcttttgcctgacattgttacagctagtttaacatgcatgggttaatttat |
43098795 |
T |
|
| Q |
213 |
ccctaaaccaaatacaaagaaacgaatcagtgtcctctgtagtaacttttgtagctttcttttttaataagtcactgttttaccaacttactcgttttga |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43098794 |
ccctaaaccaaatacaaagaaacgaatcagtgtcctctgtagtaacttttgtagctttcttttttaataagtcactgttttaccaacttactcgttttga |
43098695 |
T |
|
| Q |
313 |
ataatatt |
320 |
Q |
| |
|
|||||||| |
|
|
| T |
43098694 |
ataatatt |
43098687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University