View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17926_low_7 (Length: 308)
Name: NF17926_low_7
Description: NF17926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17926_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 294
Target Start/End: Complemental strand, 27762085 - 27761791
Alignment:
| Q |
1 |
caaaattttctttccaatattcttttggaaaatccattatacaaatccaaatatgtgcatgagtttgatttcgtgtgctatggttaaaattcctt-acta |
99 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27762085 |
caaaattttctttccaatatgcttttggaaaatccattatacaaatccaaatatgtgcatgggtttgatttcgtgtgctatggttaaaattcctttacta |
27761986 |
T |
|
| Q |
100 |
ttgtgatagtcgaaggcacctgattttaaactcattgtgccgctagcccagaccaaacataaatcatcataatttaaaaattagaaatcgtaaaacctac |
199 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
27761985 |
ttgtgatagtcgaagccacctgattttaaactcattgtgccgctagcccagaccaaacataaatcgtcataatttaaaaattagaaatcataaaacctac |
27761886 |
T |
|
| Q |
200 |
atccgagagagaacatttttcatttacctgtagtgttccacaacttggtaagcttctgaagcaaatcctttgatatgtatgacttatcccctttg |
294 |
Q |
| |
|
|||| ||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27761885 |
atccaagagagaacctttttcatttaccagtagtgttccacaacttggtaagcttctgaagcaaatcctttgatatgtatgacttatcccctttg |
27761791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University