View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17927_high_16 (Length: 256)
Name: NF17927_high_16
Description: NF17927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17927_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 15 - 238
Target Start/End: Original strand, 14240193 - 14240416
Alignment:
| Q |
15 |
gagatgaatccattgcggtggcgattgggggaattaggtgggaaggtgaaacggcgtcgtagagtgggtctaaaggctgggaatggttgaggagggtttg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14240193 |
gagatgaatccattgcggtggcgattgggggaattaggtgggaaggtgaaacggcgtcgtagagtgggtctaaaggttgggaatggttgaggagggtttg |
14240292 |
T |
 |
| Q |
115 |
gagagaagagagggattgttcggagagtggttgtggattttcggtgtggtgggtttcgcggaggtcggagatttctgttacgatgcgggagattgtttcg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14240293 |
gagagaagagagggattgttcggagagtggttgtggattttcggtgtggtgggtttcgcggaggtcggagatttctgttacgatgcgggagattgtttcg |
14240392 |
T |
 |
| Q |
215 |
ttgtccatctccggtggcgctact |
238 |
Q |
| |
|
| |||||||||||||||||||||| |
|
|
| T |
14240393 |
tcgtccatctccggtggcgctact |
14240416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 15 - 238
Target Start/End: Complemental strand, 49946415 - 49946192
Alignment:
| Q |
15 |
gagatgaatccattgcggtggcgattgggggaattaggtgggaaggtgaaacggcgtcgtagagtgggtctaaaggctgggaatggttgaggagggtttg |
114 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49946415 |
gagatgaatccattgtggtgtcgattgggggaattaggtgggaaggtgaaacggcgtcgtagagtgggtctaaaggttgggaatggttgaggagggtttg |
49946316 |
T |
 |
| Q |
115 |
gagagaagagagggattgttcggagagtggttgtggattttcggtgtggtgggtttcgcggaggtcggagatttctgttacgatgcgggagattgtttcg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49946315 |
gagagaagagagggattgttcggagagtggttgtggattttcggtgtggtgggtttcgcggaggtcggagatttctgttacgatgcgggagattgtttcg |
49946216 |
T |
 |
| Q |
215 |
ttgtccatctccggtggcgctact |
238 |
Q |
| |
|
| |||||||||||||||||||||| |
|
|
| T |
49946215 |
tcgtccatctccggtggcgctact |
49946192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 238
Target Start/End: Complemental strand, 16729024 - 16728801
Alignment:
| Q |
15 |
gagatgaatccattgcggtggcgattgggggaattaggtgggaaggtgaaacggcgtcgtagagtgggtctaaaggctgggaatggttgaggagggtttg |
114 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
16729024 |
gagatgaatccattgcggtgtcgattgggggaattaggtgggaaggtgaaacggcgtcgtagagtgggtctaaaggttgggaatggtttaggagggtttg |
16728925 |
T |
 |
| Q |
115 |
gagagaagagagggattgttcggagagtggttgtggattttcggtgtggtgggtttcgcggaggtcggagatttctgttacgatgcgggagattgtttcg |
214 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16728924 |
gagagaagagagggatttttcggagagtggttgtggattttcagtgtggtgggtttcgcgtaggtcggagatttctgttataatgcgggagattgtttcg |
16728825 |
T |
 |
| Q |
215 |
ttgtccatctccggtggcgctact |
238 |
Q |
| |
|
| |||||||||||||||||||||| |
|
|
| T |
16728824 |
tcgtccatctccggtggcgctact |
16728801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University