View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17927_high_17 (Length: 248)
Name: NF17927_high_17
Description: NF17927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17927_high_17 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 51 - 248
Target Start/End: Original strand, 27248198 - 27248395
Alignment:
| Q |
51 |
agatcggacggtctatattttattttttagaaaattaaaatctatattgaaatttagatcgtcggatctcaatcaatggtctcagatgttgttacttgtg |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27248198 |
agatcggacggtctatattttattttttagaaaattaaaatctatattaaaatttagattgtctgatctcaatcaatggtctcagatgttgttacttgtg |
27248297 |
T |
 |
| Q |
151 |
accgcgcgaatttggcaaattgccgacggtagaaaatcaaatttcatactagtagaccaataaagtacatggggatataaccaagttgtttgggctcc |
248 |
Q |
| |
|
|| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27248298 |
actgcgcgaatttggcaaattgtcgacggtagaaaatcaaatttcatactagtagaccactaaagtacatggggatataaccaagttgcttgggctcc |
27248395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 5 - 51
Target Start/End: Original strand, 21192466 - 21192512
Alignment:
| Q |
5 |
ggtagattatactgttagtttcataagataaaatagctaccttgcaa |
51 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21192466 |
ggtagattgcactgttagtttcataagataaaatagctaccttgcaa |
21192512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 22 - 51
Target Start/End: Original strand, 27248061 - 27248090
Alignment:
| Q |
22 |
gtttcataagataaaatagctaccttgcaa |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
27248061 |
gtttcataagataaaatagctaccttgcaa |
27248090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University