View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17927_high_21 (Length: 237)
Name: NF17927_high_21
Description: NF17927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17927_high_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 44051259 - 44051123
Alignment:
| Q |
1 |
ttttgattcgagtcatttaaattagttaaaccacataattcagatgagtcaacagttcgatgttctgttcaattgcttgaaacatgtaataatttctgat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44051259 |
ttttgattcgagtcatttaaattagttaaaccacataattcagatgaatcaacagttcgatgttctgttcaattgcttgaaacatgtaataatttctga- |
44051161 |
T |
|
| Q |
101 |
atgccgggggaataaaataaaggaagacatgacccacaaccac |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44051160 |
-----aggggaataaaataaaggaagacatgacccacaaccac |
44051123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 168 - 221
Target Start/End: Complemental strand, 44051085 - 44051032
Alignment:
| Q |
168 |
taatttccaaccgaactattgagagccattcaacaaaagaaaactaatgctttc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44051085 |
taatttccaaccgaactattgagagccattcaacaaaagaaaactaatgctttc |
44051032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University