View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17927_low_13 (Length: 341)
Name: NF17927_low_13
Description: NF17927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17927_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 15 - 325
Target Start/End: Complemental strand, 7261021 - 7260711
Alignment:
| Q |
15 |
tcaaacttaaaggatacttgctgataaagtatcagcaactggatacttggttgttgttcctgatcttctatatggtgactacgctgatattgataatccg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7261021 |
tcaaacttaaaggatacttgctgataaagtatcagcaactggatacttggttgttgttcctgatcttctatatggtgactacgctgatattgataatccg |
7260922 |
T |
 |
| Q |
115 |
caattcgatcgattttcatggagaaaggctcatggaccggtcagtttcttgctcacaaatgcaannnnnnnnnnnnnnnnnctacatatgatttcacagt |
214 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
7260921 |
caattcgaccgattttcatggagaaaggctcatggaccggtcagtttcttgatcacaaatgcaattttttattttctttttatacatatgatttcacagt |
7260822 |
T |
 |
| Q |
215 |
tcatatcatagcaataacattcattttgatgatccttattgcaggacaaggcatgtgaagataccaagcctttaattgctgctctaaggagtaaaggtgt |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7260821 |
tcatatcatagcaataacattcattttgatgatccttattacaggacaaggcatgtgaagataccaagcctttaattgctgctctaaggagtaaaggtgt |
7260722 |
T |
 |
| Q |
315 |
tacatcaatag |
325 |
Q |
| |
|
||||||||||| |
|
|
| T |
7260721 |
tacatcaatag |
7260711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University