View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17927_low_28 (Length: 216)
Name: NF17927_low_28
Description: NF17927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17927_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 24848430 - 24848627
Alignment:
| Q |
1 |
ataatctaattaatttgcaatattgtactgttccaagaaagacatgtnnnnnnnnnnnnnnntttt-ggagaacaaatatgtttagattaaatttgaatt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| || |||||||||||||||||||||||| |||||||| |
|
|
| T |
24848430 |
ataatctaattaatttgcaatattgtactgttgcaagaaagacatgtaaaaaaaaacaaaaaaattaggagaacaaatatgtttagattaactttgaatt |
24848529 |
T |
 |
| Q |
100 |
tagcataatctatcatttgaa--ttcaaccaaatcaccatgttaccataattttattaaattcaccgtaatttcaaatatacatgaatccaactcaac |
195 |
Q |
| |
|
||||||| ||||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24848530 |
tagcatattctatcatttgaagcttcaaccgaatcaccatgttaccgtaattttattaaattcaccgtaaattcaaatatacatgaatccaactcaac |
24848627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University