View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17927_low_6 (Length: 471)
Name: NF17927_low_6
Description: NF17927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17927_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 5e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 5e-94
Query Start/End: Original strand, 169 - 384
Target Start/End: Complemental strand, 14789004 - 14788789
Alignment:
| Q |
169 |
gataaagacatacaaaggtcgtgtataactcgtgtcaatttcatgtcttcatcatcgtgttattcagcatttgttgctatgaaattttgggaatgg---a |
265 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |||||||||||||||| | |
|
|
| T |
14789004 |
gataaagatatacaaaggtcgtgtataactcgtgtcaatatcatgtcttcatc---gtgttattcagcatttgttgctacgaaattttgggaatggtgga |
14788908 |
T |
 |
| Q |
266 |
tgctcaatattttcatcatatgtcacctttaataattcattttttctaaaactcttgactttacaatgaattgtgaggattttaatgaatcctcaaatca |
365 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14788907 |
tgctcaatattttcatcatatgtcacctttaataattcattttttctaaaactcttgactttacaatgaattgtgaggattttaatgaatcctcatatca |
14788808 |
T |
 |
| Q |
366 |
catgagagaatccattctt |
384 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
14788807 |
catgagagaatccattctt |
14788789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University