View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17929_low_11 (Length: 201)
Name: NF17929_low_11
Description: NF17929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17929_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 10 - 188
Target Start/End: Complemental strand, 8679950 - 8679772
Alignment:
| Q |
10 |
catcatcaatagaggataagatgttaaaataaaatactttccattaaattatataggatgatatgtaagaggtcaagtaagattgaaatgaaaacaaaaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8679950 |
catcatcaatagaggataagatgttaaaataaaatactttccattaaattatataggatgatatgtaagaggtcaagtaagattgaaatgaaaacaaaaa |
8679851 |
T |
|
| Q |
110 |
ctatcttaacaagaattcgaatattgctaaaattatcttgaagcataattacatttttcactaccatatcttttcattt |
188 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8679850 |
ctatcttaacaagaattcagatattgctaaaattatcttgaagcataattacatttttcactaccatatcctttcattt |
8679772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University