View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17929_low_9 (Length: 261)
Name: NF17929_low_9
Description: NF17929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17929_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 15 - 248
Target Start/End: Complemental strand, 23983457 - 23983222
Alignment:
| Q |
15 |
attattatcagtgattatgcgttactatcgtgtctgaatgttatctctgagtaattgcttcatagattacttgnnnnnnnnnnnnnnnnnnnnnnncctt |
114 |
Q |
| |
|
||||||||||||| | |||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
23983457 |
attattatcagtgttgatgcgtcactatcgtgtctgaatgttgtctctgagtaattgcttcatagattacttgtttttcctctctttttattttttcctt |
23983358 |
T |
|
| Q |
115 |
a-tatgcatgaattggattaggcactatcatcataacttacgccatgagggattactgattaaagaaag-nnnnnnnggaaataaaggaatctattctct |
212 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
23983357 |
aatatgcatgaattggattaggcactatcatcataacttacactatgagggattactgattaaagaaagaaaaaaaaggaaataaaggaatccattctct |
23983258 |
T |
|
| Q |
213 |
ttgaatttctgtcattttgcataaattagtgttttc |
248 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23983257 |
ttgaatttctgtcattttgtataaattagtgttttc |
23983222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University