View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17930_high_8 (Length: 253)
Name: NF17930_high_8
Description: NF17930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17930_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 182 - 239
Target Start/End: Complemental strand, 7509182 - 7509125
Alignment:
| Q |
182 |
tgaagcaaggtgccaccattctccttaatgcaattcaaaatggggagaggaagaaatt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7509182 |
tgaagcaaggtgccaccattctccttaatgcaattcaaaatggggagaggaagaaatt |
7509125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 182 - 239
Target Start/End: Original strand, 27241492 - 27241549
Alignment:
| Q |
182 |
tgaagcaaggtgccaccattctccttaatgcaattcaaaatggggagaggaagaaatt |
239 |
Q |
| |
|
|||| ||| ||| ||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
27241492 |
tgaatcaatgtgtcaccattcttcttaatgcaattcaaaatggtgagaggaagaaatt |
27241549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 195 - 239
Target Start/End: Original strand, 27249111 - 27249155
Alignment:
| Q |
195 |
caccattctccttaatgcaattcaaaatggggagaggaagaaatt |
239 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
27249111 |
caccattcttcttaatgcaattcaaaatggcgagaggaagaaatt |
27249155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University