View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17930_low_15 (Length: 244)
Name: NF17930_low_15
Description: NF17930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17930_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 15 - 128
Target Start/End: Original strand, 52182412 - 52182526
Alignment:
| Q |
15 |
gcagcacagagaacgtggagtgtggcagttaaattaattaaggatttctttcgttattttannnnnnnaagaaagaaac-ttattttttactacatacac |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
52182412 |
gcagcacagagaacgtggagtgtggcagttaaattaattaaggatttctttcgttattttatttttttaagaaagaaactttattttttactacatacac |
52182511 |
T |
 |
| Q |
114 |
gtacactgacaatgt |
128 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
52182512 |
gtacactgacaatgt |
52182526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 138 - 221
Target Start/End: Original strand, 52182571 - 52182654
Alignment:
| Q |
138 |
ttcatctagttgaggcttttcaaagattggtagctttgaaacgttttggcacacgtcctgctcctaaaatatagggacccaact |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52182571 |
ttcatctagttgaggcttttcaaagattggtagctttgaaacgttttggcacacgtcctgctcctaaaatatagggacccaact |
52182654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University