View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17931_high_1 (Length: 261)
Name: NF17931_high_1
Description: NF17931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17931_high_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 17 - 250
Target Start/End: Complemental strand, 40113200 - 40112967
Alignment:
| Q |
17 |
cttctgaacggaaaccttagttgcttcaaggccatgaagaaatctcgattgccattcttccgaaaagtatttcaggaagagctccttgattctgattagc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40113200 |
cttctgaacggaaaccttagttgcttcaaggccatgaagaaatctcgattgccattcttccaaaaagtatttcaggaagagctccttgattctgattagt |
40113101 |
T |
 |
| Q |
117 |
aaatggaatagaaatcacatgattataagcaactgctctaagcagtttgtgattaatgaatgggtttctgcagctagaaattgtctcatcagacacaaaa |
216 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40113100 |
aaacggaatagaaatcacatgattataagcaactgctcaaaggagtttgtgattaatgaatgggtttctgcagctagaaattgtctcatcaaacacaaaa |
40113001 |
T |
 |
| Q |
217 |
ttttgcactttgaatgcacaaaagaagcatgatg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40113000 |
ttttgcactttgaatgcacaaaagaagcatgatg |
40112967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University