View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17931_low_3 (Length: 261)

Name: NF17931_low_3
Description: NF17931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17931_low_3
NF17931_low_3
[»] chr1 (1 HSPs)
chr1 (17-250)||(40112967-40113200)


Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 17 - 250
Target Start/End: Complemental strand, 40113200 - 40112967
Alignment:
17 cttctgaacggaaaccttagttgcttcaaggccatgaagaaatctcgattgccattcttccgaaaagtatttcaggaagagctccttgattctgattagc 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||     
40113200 cttctgaacggaaaccttagttgcttcaaggccatgaagaaatctcgattgccattcttccaaaaagtatttcaggaagagctccttgattctgattagt 40113101  T
117 aaatggaatagaaatcacatgattataagcaactgctctaagcagtttgtgattaatgaatgggtttctgcagctagaaattgtctcatcagacacaaaa 216  Q
    ||| |||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
40113100 aaacggaatagaaatcacatgattataagcaactgctcaaaggagtttgtgattaatgaatgggtttctgcagctagaaattgtctcatcaaacacaaaa 40113001  T
217 ttttgcactttgaatgcacaaaagaagcatgatg 250  Q
    ||||||||||||||||||||||||||||||||||    
40113000 ttttgcactttgaatgcacaaaagaagcatgatg 40112967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University