View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17932_high_17 (Length: 265)
Name: NF17932_high_17
Description: NF17932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17932_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 9e-82; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 17 - 181
Target Start/End: Original strand, 267836 - 267998
Alignment:
| Q |
17 |
agatccaactcaagtcttgaaatgaatgcatgaatttttccatgtgcttgttgttttgtggaatattttgttctattcagcttcttttcattgtgtctta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
267836 |
agatccaactcaagtcttgaaatgaatgcatgaatttttccatgtgcttgttgttttgtggaatattttgttctattcagcttcttttcat--tgtctta |
267933 |
T |
 |
| Q |
117 |
atttcaacataaaattagtattcaattcagctgggtgagaatatttcagtggaattttttgttga |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
267934 |
atttcaacataaaattagtattcaattcagctgggtgagaatatttcagtggaattttttgttga |
267998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 179 - 256
Target Start/End: Original strand, 268030 - 268107
Alignment:
| Q |
179 |
tgaatattttatttttgtggaattggtctttctatgaccacctgcataatatttacttctgctgaacttcttctcact |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
268030 |
tgaatattttatttttgtggaattggtctttctattaccacctgcataatatttacttctgctgaacttcttttcact |
268107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University