View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17932_low_11 (Length: 389)
Name: NF17932_low_11
Description: NF17932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17932_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 168 - 373
Target Start/End: Original strand, 34669118 - 34669323
Alignment:
| Q |
168 |
atggatcataataatttcactgctgcagattttggagacaatagattttttggatcaaacacaaagtttgctcaaggagatagacaatatcaacatgata |
267 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| || ||| |||||||| |
|
|
| T |
34669118 |
atggatgataatactttcactgctgcagattttggagacaacagattttttggatcaaacacaaagtttactcaaggagataaacggtattgacatgata |
34669217 |
T |
|
| Q |
268 |
gacgagtccggaaatgaagttttatcaatggattttaccaatgatgatctcaatgggttgctagcttccatttcctctgaaaattcatgtgattggaatc |
367 |
Q |
| |
|
|||| ||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34669218 |
gacgggtcaggaaatgaagttttatcgatggattttacaaatgatgatctcaacgggttgctagcttccatttcctctaaaaattcatgtgattggaatc |
34669317 |
T |
|
| Q |
368 |
tcaaat |
373 |
Q |
| |
|
| |||| |
|
|
| T |
34669318 |
taaaat |
34669323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 34668991 - 34669111
Alignment:
| Q |
1 |
taataaaacattatgattattctgtcatgatttgcatgcagaaatattcttagggaatagcattttcattagctatttcattatcttttttgatgctagt |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
34668991 |
taataaaacactatgattattctgtcatgatttgcatgcagaaatattattagggaatagcattttcattagctattttattatctttttttatgctagt |
34669090 |
T |
|
| Q |
101 |
taacatgcatgtttcacctag |
121 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
34669091 |
taacatgcatgcttcacctag |
34669111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University