View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17932_low_12 (Length: 376)
Name: NF17932_low_12
Description: NF17932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17932_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 184 - 361
Target Start/End: Complemental strand, 30440710 - 30440547
Alignment:
| Q |
184 |
ttttattggaacgatgagctcgcatctatgataggatatgtcttcgctctgcttttgaagtatgaaaaagctgttgtcgctttgttagatcaaatggcag |
283 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30440710 |
ttttattggaacgatgagctcgcatccatgataggatatgacttcgctctgcttttgaagtatgaaaaagctgctgtcgctttgttagatcaaatggcag |
30440611 |
T |
|
| Q |
284 |
aattcactattaaagatctcctagatagagaaatttatccagaagatctagaagattatattcgtaagttctttaatg |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
30440610 |
-----actattaaagatctcctagatagagaaattt---------atctagaaaattatattcgtaagttctttaatg |
30440547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 109; E-Value: 9e-55
Query Start/End: Original strand, 14 - 134
Target Start/End: Complemental strand, 30440832 - 30440712
Alignment:
| Q |
14 |
aaaggggtagataaagggacctgggtgtctattatagcgcacccagacaaaggttttttcctctctttcgctctaactataaattttggaaaaagagttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30440832 |
aaaggggtagataaagggacctgggtgtctatcacagcgcacccagacaaaggttttttcctctctttcgctctaactataaatcttggaaaaagagttt |
30440733 |
T |
|
| Q |
114 |
atttcgcgtatgaggttgtcc |
134 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
30440732 |
atttcgcgtatgaggttgtcc |
30440712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University