View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17932_low_22 (Length: 246)
Name: NF17932_low_22
Description: NF17932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17932_low_22 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 16 - 246
Target Start/End: Original strand, 104153 - 104383
Alignment:
| Q |
16 |
attaatcaatttatgtcaaagttcagtaaatataagataagagcttaactaatttgcttacagaaactgaagatggtgaaggttccctagttgaggaacc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
104153 |
attaatcaatttatgtcaaagttcagtaaatataagataagagcttaactaatttgcttacagaaactgaagatggtgaaggttccctagttgaggaacc |
104252 |
T |
 |
| Q |
116 |
aaatgaccagaaagttttgcatgtccaaggtctctacaatgcatagatgaggaaccaaattaattaacagtgttgaggtgagtaataattggtaaggttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
104253 |
aaatgaccagaaagttttgcatgtccaaggtctctacaatgcatagatgaggaaccaaattaattaacagtgttgaggtgagtaataattggtaaggttg |
104352 |
T |
 |
| Q |
216 |
aagaaaagaagagaaagtaaaagatagttac |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
104353 |
aagaaaagaagagaaagtaaaagatagttac |
104383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University