View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17933_high_22 (Length: 227)
Name: NF17933_high_22
Description: NF17933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17933_high_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 5 - 97
Target Start/End: Original strand, 510305 - 510397
Alignment:
| Q |
5 |
ttttgcgtgcataaaggattacattgcattatagagaagaagaatagctatttgaacattcattcaagttgagcttcaactagctagcttatg |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
510305 |
ttttgcgtgcataaaggattacattgcattatagagaagaagaatagctatttgaacattcattcaagttgagcttcaactagctagcttatg |
510397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 510488 - 510537
Alignment:
| Q |
178 |
gaaggaaacatgatgattgaaagcttatgctaaagagaagaccacgcggc |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
510488 |
gaaggaaacatgatgattgaaagcttatgctaaagagaagaccacgcggc |
510537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University