View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17933_low_11 (Length: 322)
Name: NF17933_low_11
Description: NF17933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17933_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 55053691 - 55053443
Alignment:
| Q |
1 |
taccaagagaccaagagttttgagtttggcatcagttttggggaaagtcatcttatttttccataaaagcttttgaacatctttgctaaaaccattaact |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55053691 |
taccaagagaccaagacttttgagtttggcatcagttttggggaaagtcatcttatttttccataaaagcttttgaacatctttgctaaaaccattaact |
55053592 |
T |
|
| Q |
101 |
tcacaccttaccttcaatccattagaagataaaggcttaccctcttgatgtgtatttaaaaatctacacgataacccataagggcaagccccttcagatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55053591 |
tcacaccttaccttcaatccattagaagataaaggcttaccctcttgatgtgtatttaaaaatctacacgataacccataagggcaagccccttcagatt |
55053492 |
T |
|
| Q |
201 |
tcaaaaaagggcattcaccctccaaatcagccaatttctgcactcatcc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55053491 |
tcaaaaaagggcattcaccctccaaatcagccaatttctgcactcatcc |
55053443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University