View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17933_low_12 (Length: 311)
Name: NF17933_low_12
Description: NF17933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17933_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 24 - 301
Target Start/End: Original strand, 39747742 - 39748018
Alignment:
| Q |
24 |
gttatgtttgttggtcttaaatctgaatatttaggtatttccacatattaatattaattaaagactaatttaatgcatgacatcaacaatgtgaagattt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39747742 |
gttatgtttgttggtcttaaatctgaatatttaggtatttccacatattaatattaattaaagactaatttaatgcatgacatcaacaatgtaaagattt |
39747841 |
T |
 |
| Q |
124 |
tgatttatgtgtgaaacaattttttatcagacttcaattacctctcgactaaactttagattatcatatctctttcccctaaaaacaagggattgtaaaa |
223 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||| |||||||||| ||| |
|
|
| T |
39747842 |
tgatttatgtgttaaacaattttttattagacttcacttacctctcgactaaactttagattatcatatctcattcccctgaaaataagggattgttaaa |
39747941 |
T |
 |
| Q |
224 |
atagtacaannnnnnnngtttacaatttcaattgaatcttcttaatatggttctgatccaactatgaatatctttctt |
301 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39747942 |
atagtacaatttttttt-tttacaatttcaattgaatcttcttaatatggttctgatccaactatgaatatctttctt |
39748018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 122 - 154
Target Start/End: Original strand, 41932045 - 41932077
Alignment:
| Q |
122 |
tttgatttatgtgtgaaacaattttttatcaga |
154 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
41932045 |
tttgatttatgagtgaaacaattttttatcaga |
41932077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University