View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17933_low_16 (Length: 281)
Name: NF17933_low_16
Description: NF17933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17933_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 108 - 280
Target Start/End: Complemental strand, 2939711 - 2939538
Alignment:
| Q |
108 |
caccgcttgaatttaaccaagaaaaa-tgacagtagtaacttccttaaattgtgcctcaaattaaaactaacttccatacataactcatttttgaggcat |
206 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2939711 |
caccgcttgaatttaaccaagaaaaaatgacagtagtaacttccttaaattgtgcctcaaattaaaactaacttccatacataactcatttttgaggcat |
2939612 |
T |
 |
| Q |
207 |
cgattattaaatggcaacaaatcacaaaaaacagcagcattagagggactgaattacagaaccgccgatattgg |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2939611 |
cgattattaaatggcaacaaatcacaaaaaacagcagcattagagggactgaattacagaaccgccgatattgg |
2939538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University