View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17933_low_20 (Length: 248)
Name: NF17933_low_20
Description: NF17933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17933_low_20 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 5 - 248
Target Start/End: Complemental strand, 43453939 - 43453696
Alignment:
| Q |
5 |
agagagatgaagaaagctattaagagcaagcatagaaaggattctgtgttctatatccttagcagaatttaatttatttacgaacggctttagcaaacag |
104 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43453939 |
agagaaatgaagaaagctattaagagcaagcatagaaaggattctgtgttctatatccttagcagaatttaatttatttacgaacggctttagcaaacag |
43453840 |
T |
|
| Q |
105 |
acacgggctgctccttgtatccctgtatctggtagagtggtcagcatgtatatgagccacgtagctgatataaagcatgctgaacgtagctctggaattc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43453839 |
acacgggctgctccttgtatccctgtatctggtagagtggtcagcatgtatatgagccacgtagctgatataaagcatgctgaacgtagctctggaattc |
43453740 |
T |
|
| Q |
205 |
tactcttcatgccatctgccaaagcttcaaaaagtataccaaac |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43453739 |
tactcttcatgccatctgccaaagcttcaaaaagtataccaaac |
43453696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University