View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17933_low_23 (Length: 237)
Name: NF17933_low_23
Description: NF17933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17933_low_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 17 - 221
Target Start/End: Original strand, 5998535 - 5998739
Alignment:
| Q |
17 |
aagagtatgcttgtctgtatgatgaaaaatgaactttagaatctagtataactcataactgatgtcacttactgccgcatgaggaggcatggaacatttt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5998535 |
aagagtatgcttgtctgtatgatgaaaaatgaactttagaatctagtataactcataactgatgtcacttactgccgcaggaggaggcatggaacatttt |
5998634 |
T |
 |
| Q |
117 |
tccactaatcgcaaacaaagctggaaactcgcgtgctgtgaagcatcatgagttattgactaacaaccacgagaagcttttgaaggaagattgggagctt |
216 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5998635 |
tccactaatcgcaaacaaagatggaaactcgcgtgctgtgaagcatcatgagttattgactaacaaccacgagaagctttcgaaggaagattgggagctt |
5998734 |
T |
 |
| Q |
217 |
caaag |
221 |
Q |
| |
|
||||| |
|
|
| T |
5998735 |
caaag |
5998739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University