View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17933_low_24 (Length: 227)

Name: NF17933_low_24
Description: NF17933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17933_low_24
NF17933_low_24
[»] chr5 (2 HSPs)
chr5 (5-97)||(510305-510397)
chr5 (178-227)||(510488-510537)


Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 5 - 97
Target Start/End: Original strand, 510305 - 510397
Alignment:
5 ttttgcgtgcataaaggattacattgcattatagagaagaagaatagctatttgaacattcattcaagttgagcttcaactagctagcttatg 97  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
510305 ttttgcgtgcataaaggattacattgcattatagagaagaagaatagctatttgaacattcattcaagttgagcttcaactagctagcttatg 510397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 510488 - 510537
Alignment:
178 gaaggaaacatgatgattgaaagcttatgctaaagagaagaccacgcggc 227  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
510488 gaaggaaacatgatgattgaaagcttatgctaaagagaagaccacgcggc 510537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University