View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17934_high_23 (Length: 202)
Name: NF17934_high_23
Description: NF17934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17934_high_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 66 - 184
Target Start/End: Original strand, 16578276 - 16578397
Alignment:
| Q |
66 |
gggacagattgaactacaacaaaggagtacataatagtgatgtaatagaaaatcaccattcacaaactggaggc---agaaggacacatgacaatgaacc |
162 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| ||||| || ||||||||||||| | ||||| ||||||||||||||||||||||| |
|
|
| T |
16578276 |
gggacaaattgaactacaacaaaggagtacataatagtgatgtgatagagaaccaccattcacaaattagaggcagaagaaggacacatgacaatgaacc |
16578375 |
T |
 |
| Q |
163 |
atgtattgttcaaagacgactt |
184 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
16578376 |
atgtattgttcaaagacaactt |
16578397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University