View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17934_high_6 (Length: 371)
Name: NF17934_high_6
Description: NF17934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17934_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 9e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 9e-89
Query Start/End: Original strand, 182 - 351
Target Start/End: Original strand, 17196414 - 17196583
Alignment:
| Q |
182 |
ccctaaccggcaagagagagaaggccaaacgaggttatgattagcgagccaatcataaagaacaggaacaagagatttccattgagagtacttctcatca |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17196414 |
ccctaaccggcaagagagagaaggccaaacgaggttatgattagcaagccaatcataaagaacaggaacaagagatttccattgagagtacttctcatca |
17196513 |
T |
|
| Q |
282 |
acagaagcttgttgttgctgctgctgatgaagctgttgctgttgcttttccttcttcgattctctcggtg |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17196514 |
acagaagcttgttgttgctgctgctgatgaagctgttgctgttgcttttccttcttcgattctctcggtg |
17196583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University