View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17934_low_26 (Length: 202)

Name: NF17934_low_26
Description: NF17934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17934_low_26
NF17934_low_26
[»] chr2 (1 HSPs)
chr2 (66-184)||(16578276-16578397)


Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 66 - 184
Target Start/End: Original strand, 16578276 - 16578397
Alignment:
66 gggacagattgaactacaacaaaggagtacataatagtgatgtaatagaaaatcaccattcacaaactggaggc---agaaggacacatgacaatgaacc 162  Q
    |||||| |||||||||||||||||||||||||||||||||||| ||||| || ||||||||||||| | |||||   |||||||||||||||||||||||    
16578276 gggacaaattgaactacaacaaaggagtacataatagtgatgtgatagagaaccaccattcacaaattagaggcagaagaaggacacatgacaatgaacc 16578375  T
163 atgtattgttcaaagacgactt 184  Q
    ||||||||||||||||| ||||    
16578376 atgtattgttcaaagacaactt 16578397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University