View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17934_low_27 (Length: 202)
Name: NF17934_low_27
Description: NF17934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17934_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 13 - 184
Target Start/End: Original strand, 35954430 - 35954603
Alignment:
| Q |
13 |
attatactcgggttggtaatttgtcttgggataatctccaaccaaaca--actannnnnnngtgctattgaagtgttccacaaccactcaagaactccca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35954430 |
attatactcgggttggtaatttgtcttgggataatctccaaccaaacacaactatttttttgtgctattgaagtgttccacaaccactcaagaactccca |
35954529 |
T |
|
| Q |
111 |
acattaaaatcatcacgaatctgcatatttttcaacgtctgataggattcttttatagtaaaaatgatgtttcc |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
35954530 |
acattaaaatcatcacgaatctgcatatttttcaacgtctgataggatcctttaatagtaaaaatgatgtttcc |
35954603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University