View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17935_high_10 (Length: 292)
Name: NF17935_high_10
Description: NF17935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17935_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 10 - 258
Target Start/End: Complemental strand, 35420730 - 35420482
Alignment:
| Q |
10 |
aaatgaagaacaatctttgtcaccagattctgtcatcaacacttgggaactcatggatggtttagatgaacatgaagattctcatcatcatgatagtgct |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35420730 |
aaatgaagaacaatctttgtcaccagattctgtcatcaacacttgggaactcatggatggtttagatgaacatgaagattctcatcatcacgatagtgct |
35420631 |
T |
 |
| Q |
110 |
actattgttcataaaccttccatttttgacaatccaatgagtttctcagataaacacagttcatgcaggtacacaacttttgatggatcagcaaaaaaga |
209 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35420630 |
actaatgttcataaaccttccatttttgacaatccaatgagtttctcggataaacacagttcatgcaggtacacaacttttgatggatcagcaaaaaaga |
35420531 |
T |
 |
| Q |
210 |
aacttcttgattcatttgaattattgaaagcttcagaaacagtgatgga |
258 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35420530 |
aacttcttgattcatttgaatcattgaaagcttcagaaacagtgatgga |
35420482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 19988674 - 19988621
Alignment:
| Q |
16 |
agaacaatctttgtcaccagattctgtcatcaacacttgggaactcatggatgg |
69 |
Q |
| |
|
|||| |||| |||||||| || || ||||||||| ||||||||||||||||||| |
|
|
| T |
19988674 |
agaagaatcattgtcacctgactcagtcatcaacgcttgggaactcatggatgg |
19988621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University